‚̧Nanobot: Polygonal Mascot
    Wondering what‚Äôs next for npm?Check out our public roadmap! ¬Ľ

    fasta-parser

    0.1.0¬†‚Äʬ†Public¬†‚Äʬ†Published

    fasta-parser

    Buffer Stream parser from FASTA to JSON.

    NPM version Build Status Coveralls Status Dependency Status Gitter chat DOI

    Browser

    Install

    Install fasta-parser with npm:

    $ npm install fasta-parser

    Alternatively, just include fasta-parser.min.js via a <script/> in your page.

    Usage

    var fasta = require('fasta-parser')
     
    var fastaData = new Buffer ('>sequence1\n\
    ATGCACGTCACGTCAGTACTCGTCAGTAC\n\
    >sequence2\n\
    CAGTCCTACTGCATGCATGCATGCATGCATCGATGCATGTCGACTGCATGCATGC\n')
     
    var parser = fasta()
    parser.on('data', function(data) { console.log(JSON.parse(data.toString())) })
    parser.write(fastaData)
    parser.end()
    //=>   { id: 'sequence1',
    //       seq: 'ATGCACGTCACGTCAGTACTCGTCAGTAC' }
    //     { id: 'sequence2',
    //       seq: 'CAGTCCTACTGCATGCATGCATGCATGCATCGATGCATGTCGACTGCATGCATGC' }

    For a more useful API, check the dependent module bionode-fasta.

    Contributing

    To contribute, clone this repo locally and commit your code on a separate branch.

    Please write unit tests for your code, and check that everything works by running the following before opening a pull-request:

    $ npm test

    To test on the browser:

    $ npm run test-browser
    # if you get "No headless browser found" do: 
    $ npm install -g phantomjs
    $ rm ~/.config/browser-launcher/config.json

    Please also check for code coverage:

    $ npm run coverage

    To rebuild and minify the module for the browser:

    $ npm run build-browser

    To rebuild the documentation using the comments in the code:

    $ npm run build-docs

    Check the issues for ways to contribute.

    Contacts

    Bruno Vieira <mail@bmpvieira.com> @bmpvieira

    License

    fasta-parser is licensed under the MIT license.
    Check ChooseALicense.com for details.

    Install

    npm i fasta-parser

    DownloadsWeekly Downloads

    13

    Version

    0.1.0

    License

    MIT

    Last publish

    Collaborators

    • avatar
    • avatar
    • avatar